rust

rust away

1. To become increasingly covered in rust. Why don't we finally sell that old car? It's just been rusting away in the street for the last two years.

2. To dissolve or disintegrate due to corrosion. The access panel completely has rusted away, exposing the sensitive electronics inside to the elements.

rust bucket

Any vehicle that is particularly old, unsophisticated, and dilapidated, especially a car; a clunker. Hyphenated when used as a modifier before a noun. When are you going to get rid of that old rust bucket and buy something you'll actually enjoy driving? I had my reservations climbing aboard the rust-bucket prop plane, but I have to say, it got us there with no issues whatsoever.

rust off

1. To erode and fall off or disintegrate as a result of rust. The iron gate is so old that the latch holding it shut has completely rusted off.

2. To cause something to become eroded by rust and fall off or disintegrate as a result. The briny sea air had rusted the metal siding right off.

rust out

1. To become thoroughly corroded by rust, especially as to cause something to be full of holes or no longer work correctly. I went to go put the pile of leaves and branches into the wheelbarrow, but the whole damn thing was rusted out! You see here? The engine block is totally rusted out, meaning we'll have the replace the whole thing.

2. To cause something to become thoroughly eaten through by rust. In this usage, a noun or pronoun can be used between "rust" and "out." Saltwater has rusted the hull out completely—the boat won't be seaworthy until you fix it. Because this part of the machine wasn't sealed correctly, moisture got in and rusted out the electronics.

rust up

1. To become thoroughly corroded by rust, especially as to cause something not to work or be able to move correctly. The nuts and bolts have all rusted up, so getting these brackets off is going to be a pain in the butt. You see here? The engine block is totally rusted up, meaning we'll have the replace the whole thing.

2. To cause something to become thoroughly corroded by rust. In this usage, a noun or pronoun can be used between "rust" and "up." You should have kept your bike in a shed or something, because the rain has rusted the chain up completely. The sea air in this town rusts up machines really badly, so we constantly have to have our things repaired or replaced.

the Rust Belt

A region of the northern United States characterized by a once-dominant industrial and manufacturing economy that has since declined. Unemployment rates are high across the country, but the Rust Belt continues to have the highest, as the manufacturing sector has been particularly slow to recover.

It is better to wear out than to rust out.

Prov. It is better to work until you die than to be idle just because you are old. Nancy: Grandma, you shouldn't work so hard. You're not young anymore, you know. Grandmother: Thanks for your concern, dear, but I plan to keep working. It's better to wear out than to rust out. Bill: You really ought to relax. I'm afraid you'll kill yourself with too much work. Nancy: So what? It's better to wear out than to rust out.

rust away

to dissolve away into rust. In a few years, this car will rust away if you don't take care of it. The bridge is rusting away, little by little.

rust belt

Fig. the industrial north of the United States. (Patterned on sun belt.) The economy in the rust belt is slowing down. The salt they put on the roads in the winter made my car all rusty. I guess that's why they call this area the rust belt.

rust out

to develop holes or weak places owing to rust. Our hot water heater rusted out and flooded the basement.

rust up

1. To become thoroughly corroded: The walls of the old ship had rusted up.

2. To become immobile or stuck due to corrosion: The bolts have rusted up; I can't remove them.

3. To cause something to be thoroughly corroded: Don't use these chemicals; they will rust up the tank. Exposure to salt rusted the fender up.

rust belt

n. the industrial north of the U.S. (Patterned on sun belt.) The salt they put on the roads in the winter made my car all rusty. I guess that’s why they call this area the rust belt.

rust bucket

n. a naval destroyer; any ship. (Military.) Why don’t I ever get assigned to a new ship? It’s always some crummy rust bucket!

词组	rust
释义	rust rust away 1. To become increasingly covered in rust. Why don't we finally sell that old car? It's just been rusting away in the street for the last two years. 2. To dissolve or disintegrate due to corrosion. The access panel completely has rusted away, exposing the sensitive electronics inside to the elements. See also: away, rust rust bucket Any vehicle that is particularly old, unsophisticated, and dilapidated, especially a car; a clunker. Hyphenated when used as a modifier before a noun. When are you going to get rid of that old rust bucket and buy something you'll actually enjoy driving? I had my reservations climbing aboard the rust-bucket prop plane, but I have to say, it got us there with no issues whatsoever. See also: bucket, rust rust off 1. To erode and fall off or disintegrate as a result of rust. The iron gate is so old that the latch holding it shut has completely rusted off. 2. To cause something to become eroded by rust and fall off or disintegrate as a result. The briny sea air had rusted the metal siding right off. See also: off, rust rust out 1. To become thoroughly corroded by rust, especially as to cause something to be full of holes or no longer work correctly. I went to go put the pile of leaves and branches into the wheelbarrow, but the whole damn thing was rusted out! You see here? The engine block is totally rusted out, meaning we'll have the replace the whole thing. 2. To cause something to become thoroughly eaten through by rust. In this usage, a noun or pronoun can be used between "rust" and "out." Saltwater has rusted the hull out completely—the boat won't be seaworthy until you fix it. Because this part of the machine wasn't sealed correctly, moisture got in and rusted out the electronics. See also: out, rust rust up 1. To become thoroughly corroded by rust, especially as to cause something not to work or be able to move correctly. The nuts and bolts have all rusted up, so getting these brackets off is going to be a pain in the butt. You see here? The engine block is totally rusted up, meaning we'll have the replace the whole thing. 2. To cause something to become thoroughly corroded by rust. In this usage, a noun or pronoun can be used between "rust" and "up." You should have kept your bike in a shed or something, because the rain has rusted the chain up completely. The sea air in this town rusts up machines really badly, so we constantly have to have our things repaired or replaced. See also: rust, up the Rust Belt A region of the northern United States characterized by a once-dominant industrial and manufacturing economy that has since declined. Unemployment rates are high across the country, but the Rust Belt continues to have the highest, as the manufacturing sector has been particularly slow to recover. See also: belt, rust Farlex Dictionary of Idioms. It is better to wear out than to rust out. Prov. It is better to work until you die than to be idle just because you are old. Nancy: Grandma, you shouldn't work so hard. You're not young anymore, you know. Grandmother: Thanks for your concern, dear, but I plan to keep working. It's better to wear out than to rust out. Bill: You really ought to relax. I'm afraid you'll kill yourself with too much work. Nancy: So what? It's better to wear out than to rust out. See also: better, out, rust, wear rust away to dissolve away into rust. In a few years, this car will rust away if you don't take care of it. The bridge is rusting away, little by little. See also: away, rust rust belt Fig. the industrial north of the United States. (Patterned on sun belt.) The economy in the rust belt is slowing down. The salt they put on the roads in the winter made my car all rusty. I guess that's why they call this area the rust belt. See also: belt, rust rust out to develop holes or weak places owing to rust. Our hot water heater rusted out and flooded the basement. See also: out, rust McGraw-Hill Dictionary of American Idioms and Phrasal Verbs. rust up v. 1. To become thoroughly corroded: The walls of the old ship had rusted up. 2. To become immobile or stuck due to corrosion: The bolts have rusted up; I can't remove them. 3. To cause something to be thoroughly corroded: Don't use these chemicals; they will rust up the tank. Exposure to salt rusted the fender up. See also: rust, up The American Heritage® Dictionary of Phrasal Verbs. rust belt n. the industrial north of the U.S. (Patterned on sun belt.) The salt they put on the roads in the winter made my car all rusty. I guess that’s why they call this area the rust belt. See also: belt, rust rust bucket n. a naval destroyer; any ship. (Military.) Why don’t I ever get assigned to a new ship? It’s always some crummy rust bucket! See also: bucket, rust McGraw-Hill's Dictionary of American Slang and Colloquial Expressions See also: rust away mist over freeze over mist up ice up haze haze over rust out get wet rust up References in periodicals archive So now we have a bottle of Brownells Classic Rust Blue and we've wiped it very sparingly onto the clean steel to begin the controlled rusting process. Rust Bluing: A classic finish, rust bluing provides the best custom gun color. Here's how to do it right Rust Bullet, LLC is a coatings manufacturer, headquartered in Reno, NV, USA, specializing in protective, rust inhibitive and corrosion control coatings. Rust Bullet, LLC Announces 2018 Black Friday Sale James Tour, a chemist, inventor and professor at Rice University in Houston who has won multiple awards for his work, invented Rust Patrol[R] after perfecting the formula over seven years. Rust Patrol[R] Gets the Job Done Right Nineteen wheat genotypes (Sonara 64, K 9351, HP 1633, Raj 4037, Sharbati Sonara, K 9533, K 8434, NP 823, Ajanta, PBW 12, KRL, RW 346, HD 2643, HS 1097, NP 825, PBW 226, NIAW 301, PBW 343, and NI 179) were selected on the basis of low disease severity under field conditions for molecular validation of stripe rust resistance gene Yr18 by using allele-specific markers Cssfr2 (F=TTGATGAAACCAGTTTTTTTTCTA R=TATGCCATTTAACATAATCATGAA). Germplasm Evaluation and Characterization of Slow Rusting Resistant Gene against Stripe Rust of Wheat WCR is actively working to create new varieties of Arabica coffee that are resistant to or tolerant of leaf rust, but higher quality than the last generation of rust-resistant varieties (commonly known as Catimors and Sarchimors). WCR's latest steps to combating leaf rust Three kinds of Rust or Kungi disease were witnessed on wheat crop last year, including Brown Rust, yellow Rust, and Black Rust as temperature ranging from 20-25 Celsius is suitable for Brown Rust, 10-20 C for Yellow Rust and 20-35 C for Black Rust. Wheat farmers told to beware of Rust disease Key words: Breeding; resistance; slow rusting genes; phenotypic markers; Triticum aestivum; leaf and stripe rust. PHENOTYPIC CHARACTERIZATION OF WHEAT SELECTED LINES FOR RESISTANCE AGAINST LEAF STRIPE AND STEM RUST THROUGH PHENOTYPIC MARKERS APPLICATION One of the big goals of Rust is to be a safe language despite being low-level; to not let performance compromise safety. Everything you need to know to get started with Rust "Michael has a deep understanding of the opportunities and challenges emerging in our rapidly changing marketplace," Rust said in a statement. State farm CEO rust to retire in September; current president to take the helm The most ef ficient and economical management of wheat rusts is the generation of rust resistant varieties and their on-farm cultivation (Chaudhary et al., 1998; Hussain et al., 1999; Kalappanavar et al., 2008). Application of Phenotypic and Molecular Markers to Combine Genes for Durable Resistance against Rust Virulences and High Yield Potential in Wheat Rust has been CEO of State Farm since 1985 and is the company's longest serving CEO. State Farm Chief Rust steps down after 30 years, names COO Tipsord successor Rust: The Longest War is recommended for any reader who enjoys a blend of science, history, and public issues, and presents a call for action in the course of discussing rust's damage and the fact that it's such a pervasive menace that it nearly brought down the Statue of Liberty, and costs this country over, $400 billion annually. Rust: The Longest War In Rust, journalist Jonathan Waldman travels from Key West to Prudhoe Bay to meet the colorful and often obsessive people concerned with corrosion. Rust: The Longest War Practically all carbon steel will rust, but stainless steel won't. The DIY rust blue
随便看	book on out book out book through book up boom boombox boom box boomer boomerang child boom goes the dynamite boom or bust boom out boom sticks boon boon companion boondocks boonies boonies, the boon or bane boo off boo off the stage boo (one) off (the) stage boosiasm boosiasms boost