Significant differences were detected in the frequencies of
Fok I genotype between the caries group and the caries-free group.
Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent
The primers used for
Fok I are forward 5' AGCTGGCCCTGGCACTGACTCTGCTCT'3 and reverse 5'ATGGAAACACCTTGCTTCTTCTCCCTC'3 and for Apa I are forward 5' CAGAGCATGGACAGGGAGCAA'3 and reverse 5'GCAACTCCTCATGGCTGAGGTCCTC' 3.
Serum vitamin D levels and gene polymorphisms (Fok1 and Apa1) in children with type I diabetes and healthy controls
Managing Director Mark Flanighan said: "I'm honestly delighted with the way Cristian has blended into
FOK Marketing.
From Italy to Teesside
"Organising such a large-scale event [like the Asian Games] always arouses public interest and participation in sports activities, bringing about substantial benefits to health and overall quality of living,"
Fok added.
Hong Kong makes all the right moves in pursuit of 2023 Games
"We chose brass as the material for the fins because it has a density about 7,000 times that of air, a large ratio that is needed to achieve the strong anisotropy required for a flat dispersion of the sound waves,"
Fok added.
World's first acoustic hyperlens could improve sonar devices
<div class="caption">Mr Timothy
Fok appointing Alan Tam, Hacken Lee and Eason Chan as the EAG Ambassadors.</div>
2009 East Asian Games: get set, go! (pictures)
Timothy
Fok, Hong Kong's Sports Federation and Olympic Committee president, who has hinted he could be one of the 120 torchbearers for the Hong Kong leg, said the protests so far ''have sacrificed the Olympic spirit.''
H.K. rights advocates mull demonstration during Olympic torch relay
Oxford University student Tsz
Fok, aged 22, who lived with his mother in Kings Heath, was described as "probably the brightest A-level candidate in the country" by exams body the Qualifications and Curriculum Authority in 2003.
Star student killed in bin lorry crash
It is thought a bid could be tabled as early as today to Canning
Fok, managing director of Hutchison Whampoa, and Ravi Ruia, vice chairman of Essar.
Vodafone mulls bid
Wie de
fok het die fokken plek toegemaak?" Die vraag hang in die lug.
O, Griet! Skryf 'n parodie: Twee sprokies op die maat van 'n Opdrag
Alternative: Czech Suite--Pesek, (Virgin), Prague Chamber Orchestra, Vlcek; Vlach (Supraphon), Polonaise in E Flat major--Neumann, Czech Philharmonic (Orfeo), Polonaises and Waltzes--Belohlavek,
FOK (Supraphon).
Antonin Dvorak
Kwon E, Zhang H, Wang Z, Jhangri GS, Lu X,
Fok N, et al.
Arsenic on children's hands after playing in playgrounds
Fong, assistant to Timothy
Fok, SFOC prexy and Intl.
Rivals wrangling over Olympic tribute show
Nineteen year Tsz
Fok from King's Heath, Birmingham spent his gap-year before University with Wolverhampton based Turner Powertrain Systems.
Industry reward
Hutchison Whampoa Ltd CEO Canning
Fok said the company's third-generation mobile operation could break even earlier than expected.
Hutchison Whampoa Expects Early Profits From 3G